ID: 1177295144

View in Genome Browser
Species Human (GRCh38)
Location 21:19163584-19163606
Sequence GGCAGAGAATCTGTGAGCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177295144_1177295152 13 Left 1177295144 21:19163584-19163606 CCCTAGCTCACAGATTCTCTGCC No data
Right 1177295152 21:19163620-19163642 TATTGCCAGGGGATGAACGAGGG No data
1177295144_1177295151 12 Left 1177295144 21:19163584-19163606 CCCTAGCTCACAGATTCTCTGCC No data
Right 1177295151 21:19163619-19163641 CTATTGCCAGGGGATGAACGAGG No data
1177295144_1177295150 2 Left 1177295144 21:19163584-19163606 CCCTAGCTCACAGATTCTCTGCC No data
Right 1177295150 21:19163609-19163631 TGTCGTATGGCTATTGCCAGGGG No data
1177295144_1177295149 1 Left 1177295144 21:19163584-19163606 CCCTAGCTCACAGATTCTCTGCC No data
Right 1177295149 21:19163608-19163630 GTGTCGTATGGCTATTGCCAGGG No data
1177295144_1177295148 0 Left 1177295144 21:19163584-19163606 CCCTAGCTCACAGATTCTCTGCC No data
Right 1177295148 21:19163607-19163629 TGTGTCGTATGGCTATTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177295144 Original CRISPR GGCAGAGAATCTGTGAGCTA GGG (reversed) Intergenic
No off target data available for this crispr