ID: 1177295146

View in Genome Browser
Species Human (GRCh38)
Location 21:19163596-19163618
Sequence GATTCTCTGCCTGTGTCGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177295141_1177295146 13 Left 1177295141 21:19163560-19163582 CCCACAATCACTGCACTCTTTCT No data
Right 1177295146 21:19163596-19163618 GATTCTCTGCCTGTGTCGTATGG No data
1177295142_1177295146 12 Left 1177295142 21:19163561-19163583 CCACAATCACTGCACTCTTTCTC No data
Right 1177295146 21:19163596-19163618 GATTCTCTGCCTGTGTCGTATGG No data
1177295143_1177295146 -10 Left 1177295143 21:19163583-19163605 CCCCTAGCTCACAGATTCTCTGC No data
Right 1177295146 21:19163596-19163618 GATTCTCTGCCTGTGTCGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177295146 Original CRISPR GATTCTCTGCCTGTGTCGTA TGG Intergenic
No off target data available for this crispr