ID: 1177295150

View in Genome Browser
Species Human (GRCh38)
Location 21:19163609-19163631
Sequence TGTCGTATGGCTATTGCCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177295144_1177295150 2 Left 1177295144 21:19163584-19163606 CCCTAGCTCACAGATTCTCTGCC No data
Right 1177295150 21:19163609-19163631 TGTCGTATGGCTATTGCCAGGGG No data
1177295141_1177295150 26 Left 1177295141 21:19163560-19163582 CCCACAATCACTGCACTCTTTCT No data
Right 1177295150 21:19163609-19163631 TGTCGTATGGCTATTGCCAGGGG No data
1177295145_1177295150 1 Left 1177295145 21:19163585-19163607 CCTAGCTCACAGATTCTCTGCCT No data
Right 1177295150 21:19163609-19163631 TGTCGTATGGCTATTGCCAGGGG No data
1177295142_1177295150 25 Left 1177295142 21:19163561-19163583 CCACAATCACTGCACTCTTTCTC No data
Right 1177295150 21:19163609-19163631 TGTCGTATGGCTATTGCCAGGGG No data
1177295143_1177295150 3 Left 1177295143 21:19163583-19163605 CCCCTAGCTCACAGATTCTCTGC No data
Right 1177295150 21:19163609-19163631 TGTCGTATGGCTATTGCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177295150 Original CRISPR TGTCGTATGGCTATTGCCAG GGG Intergenic
No off target data available for this crispr