ID: 1177307815

View in Genome Browser
Species Human (GRCh38)
Location 21:19343032-19343054
Sequence TTTATGTTGCTAGTGGCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177307815_1177307817 18 Left 1177307815 21:19343032-19343054 CCTGAAGCCACTAGCAACATAAA No data
Right 1177307817 21:19343073-19343095 TGAAGTCAAACACCTAATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177307815 Original CRISPR TTTATGTTGCTAGTGGCTTC AGG (reversed) Intergenic
No off target data available for this crispr