ID: 1177315278

View in Genome Browser
Species Human (GRCh38)
Location 21:19452459-19452481
Sequence TGAGTTGCAAACTAAAAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177315278_1177315281 21 Left 1177315278 21:19452459-19452481 CCAGACTTTTAGTTTGCAACTCA No data
Right 1177315281 21:19452503-19452525 AGAGAAAGCCACAAGTAGAATGG No data
1177315278_1177315279 -6 Left 1177315278 21:19452459-19452481 CCAGACTTTTAGTTTGCAACTCA No data
Right 1177315279 21:19452476-19452498 AACTCACAGAACTACATCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177315278 Original CRISPR TGAGTTGCAAACTAAAAGTC TGG (reversed) Intergenic
No off target data available for this crispr