ID: 1177318143

View in Genome Browser
Species Human (GRCh38)
Location 21:19487757-19487779
Sequence CCTCACCTGCAGAACCTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177318143_1177318148 5 Left 1177318143 21:19487757-19487779 CCTCCCAGGTTCTGCAGGTGAGG No data
Right 1177318148 21:19487785-19487807 GAAAGTAAACTGACAAAAACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177318143 Original CRISPR CCTCACCTGCAGAACCTGGG AGG (reversed) Intergenic
No off target data available for this crispr