ID: 1177318696

View in Genome Browser
Species Human (GRCh38)
Location 21:19493628-19493650
Sequence TCGCGCTGGCCGGCAAGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177318696_1177318712 30 Left 1177318696 21:19493628-19493650 CCGGCGCTTGCCGGCCAGCGCGA No data
Right 1177318712 21:19493681-19493703 GGCACTCGGAGCGGCCGGCCGGG No data
1177318696_1177318708 25 Left 1177318696 21:19493628-19493650 CCGGCGCTTGCCGGCCAGCGCGA No data
Right 1177318708 21:19493676-19493698 GGCCCGGCACTCGGAGCGGCCGG 0: 5
1: 69
2: 434
3: 513
4: 506
1177318696_1177318711 29 Left 1177318696 21:19493628-19493650 CCGGCGCTTGCCGGCCAGCGCGA No data
Right 1177318711 21:19493680-19493702 CGGCACTCGGAGCGGCCGGCCGG No data
1177318696_1177318701 -5 Left 1177318696 21:19493628-19493650 CCGGCGCTTGCCGGCCAGCGCGA No data
Right 1177318701 21:19493646-19493668 CGCGAGTTCCAGGTGAACGTGGG No data
1177318696_1177318705 9 Left 1177318696 21:19493628-19493650 CCGGCGCTTGCCGGCCAGCGCGA No data
Right 1177318705 21:19493660-19493682 GAACGTGGGCTCGGCAGGCCCGG No data
1177318696_1177318706 16 Left 1177318696 21:19493628-19493650 CCGGCGCTTGCCGGCCAGCGCGA No data
Right 1177318706 21:19493667-19493689 GGCTCGGCAGGCCCGGCACTCGG No data
1177318696_1177318704 4 Left 1177318696 21:19493628-19493650 CCGGCGCTTGCCGGCCAGCGCGA No data
Right 1177318704 21:19493655-19493677 CAGGTGAACGTGGGCTCGGCAGG No data
1177318696_1177318702 0 Left 1177318696 21:19493628-19493650 CCGGCGCTTGCCGGCCAGCGCGA No data
Right 1177318702 21:19493651-19493673 GTTCCAGGTGAACGTGGGCTCGG No data
1177318696_1177318707 21 Left 1177318696 21:19493628-19493650 CCGGCGCTTGCCGGCCAGCGCGA No data
Right 1177318707 21:19493672-19493694 GGCAGGCCCGGCACTCGGAGCGG No data
1177318696_1177318700 -6 Left 1177318696 21:19493628-19493650 CCGGCGCTTGCCGGCCAGCGCGA No data
Right 1177318700 21:19493645-19493667 GCGCGAGTTCCAGGTGAACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177318696 Original CRISPR TCGCGCTGGCCGGCAAGCGC CGG (reversed) Intergenic
No off target data available for this crispr