ID: 1177318699

View in Genome Browser
Species Human (GRCh38)
Location 21:19493642-19493664
Sequence CGTTCACCTGGAACTCGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177318699_1177318712 16 Left 1177318699 21:19493642-19493664 CCAGCGCGAGTTCCAGGTGAACG No data
Right 1177318712 21:19493681-19493703 GGCACTCGGAGCGGCCGGCCGGG No data
1177318699_1177318714 25 Left 1177318699 21:19493642-19493664 CCAGCGCGAGTTCCAGGTGAACG No data
Right 1177318714 21:19493690-19493712 AGCGGCCGGCCGGGGCAGTGAGG No data
1177318699_1177318715 26 Left 1177318699 21:19493642-19493664 CCAGCGCGAGTTCCAGGTGAACG No data
Right 1177318715 21:19493691-19493713 GCGGCCGGCCGGGGCAGTGAGGG No data
1177318699_1177318707 7 Left 1177318699 21:19493642-19493664 CCAGCGCGAGTTCCAGGTGAACG No data
Right 1177318707 21:19493672-19493694 GGCAGGCCCGGCACTCGGAGCGG No data
1177318699_1177318708 11 Left 1177318699 21:19493642-19493664 CCAGCGCGAGTTCCAGGTGAACG No data
Right 1177318708 21:19493676-19493698 GGCCCGGCACTCGGAGCGGCCGG 0: 5
1: 69
2: 434
3: 513
4: 506
1177318699_1177318716 27 Left 1177318699 21:19493642-19493664 CCAGCGCGAGTTCCAGGTGAACG No data
Right 1177318716 21:19493692-19493714 CGGCCGGCCGGGGCAGTGAGGGG No data
1177318699_1177318711 15 Left 1177318699 21:19493642-19493664 CCAGCGCGAGTTCCAGGTGAACG No data
Right 1177318711 21:19493680-19493702 CGGCACTCGGAGCGGCCGGCCGG No data
1177318699_1177318706 2 Left 1177318699 21:19493642-19493664 CCAGCGCGAGTTCCAGGTGAACG No data
Right 1177318706 21:19493667-19493689 GGCTCGGCAGGCCCGGCACTCGG No data
1177318699_1177318705 -5 Left 1177318699 21:19493642-19493664 CCAGCGCGAGTTCCAGGTGAACG No data
Right 1177318705 21:19493660-19493682 GAACGTGGGCTCGGCAGGCCCGG No data
1177318699_1177318713 17 Left 1177318699 21:19493642-19493664 CCAGCGCGAGTTCCAGGTGAACG No data
Right 1177318713 21:19493682-19493704 GCACTCGGAGCGGCCGGCCGGGG No data
1177318699_1177318704 -10 Left 1177318699 21:19493642-19493664 CCAGCGCGAGTTCCAGGTGAACG No data
Right 1177318704 21:19493655-19493677 CAGGTGAACGTGGGCTCGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177318699 Original CRISPR CGTTCACCTGGAACTCGCGC TGG (reversed) Intergenic
No off target data available for this crispr