ID: 1177318700

View in Genome Browser
Species Human (GRCh38)
Location 21:19493645-19493667
Sequence GCGCGAGTTCCAGGTGAACG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177318696_1177318700 -6 Left 1177318696 21:19493628-19493650 CCGGCGCTTGCCGGCCAGCGCGA No data
Right 1177318700 21:19493645-19493667 GCGCGAGTTCCAGGTGAACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177318700 Original CRISPR GCGCGAGTTCCAGGTGAACG TGG Intergenic
No off target data available for this crispr