ID: 1177318702

View in Genome Browser
Species Human (GRCh38)
Location 21:19493651-19493673
Sequence GTTCCAGGTGAACGTGGGCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177318698_1177318702 -10 Left 1177318698 21:19493638-19493660 CCGGCCAGCGCGAGTTCCAGGTG No data
Right 1177318702 21:19493651-19493673 GTTCCAGGTGAACGTGGGCTCGG No data
1177318696_1177318702 0 Left 1177318696 21:19493628-19493650 CCGGCGCTTGCCGGCCAGCGCGA No data
Right 1177318702 21:19493651-19493673 GTTCCAGGTGAACGTGGGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177318702 Original CRISPR GTTCCAGGTGAACGTGGGCT CGG Intergenic
No off target data available for this crispr