ID: 1177318707

View in Genome Browser
Species Human (GRCh38)
Location 21:19493672-19493694
Sequence GGCAGGCCCGGCACTCGGAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177318699_1177318707 7 Left 1177318699 21:19493642-19493664 CCAGCGCGAGTTCCAGGTGAACG No data
Right 1177318707 21:19493672-19493694 GGCAGGCCCGGCACTCGGAGCGG No data
1177318698_1177318707 11 Left 1177318698 21:19493638-19493660 CCGGCCAGCGCGAGTTCCAGGTG No data
Right 1177318707 21:19493672-19493694 GGCAGGCCCGGCACTCGGAGCGG No data
1177318703_1177318707 -5 Left 1177318703 21:19493654-19493676 CCAGGTGAACGTGGGCTCGGCAG No data
Right 1177318707 21:19493672-19493694 GGCAGGCCCGGCACTCGGAGCGG No data
1177318696_1177318707 21 Left 1177318696 21:19493628-19493650 CCGGCGCTTGCCGGCCAGCGCGA No data
Right 1177318707 21:19493672-19493694 GGCAGGCCCGGCACTCGGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177318707 Original CRISPR GGCAGGCCCGGCACTCGGAG CGG Intergenic
No off target data available for this crispr