ID: 1177319868

View in Genome Browser
Species Human (GRCh38)
Location 21:19508029-19508051
Sequence CCTGACATGCACCCCAAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177319868_1177319873 21 Left 1177319868 21:19508029-19508051 CCTGTCTTGGGGTGCATGTCAGG No data
Right 1177319873 21:19508073-19508095 GGATGTAGATATCCCACACCAGG No data
1177319868_1177319870 -9 Left 1177319868 21:19508029-19508051 CCTGTCTTGGGGTGCATGTCAGG No data
Right 1177319870 21:19508043-19508065 CATGTCAGGTTTGACGTCTGTGG No data
1177319868_1177319874 29 Left 1177319868 21:19508029-19508051 CCTGTCTTGGGGTGCATGTCAGG No data
Right 1177319874 21:19508081-19508103 ATATCCCACACCAGGATCTGAGG No data
1177319868_1177319872 0 Left 1177319868 21:19508029-19508051 CCTGTCTTGGGGTGCATGTCAGG No data
Right 1177319872 21:19508052-19508074 TTTGACGTCTGTGGCAGGATTGG No data
1177319868_1177319871 -5 Left 1177319868 21:19508029-19508051 CCTGTCTTGGGGTGCATGTCAGG No data
Right 1177319871 21:19508047-19508069 TCAGGTTTGACGTCTGTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177319868 Original CRISPR CCTGACATGCACCCCAAGAC AGG (reversed) Intergenic
No off target data available for this crispr