ID: 1177320520

View in Genome Browser
Species Human (GRCh38)
Location 21:19513915-19513937
Sequence CACGGAATTCAGGTGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177320520_1177320527 -5 Left 1177320520 21:19513915-19513937 CCTGCTTCCACCTGAATTCCGTG No data
Right 1177320527 21:19513933-19513955 CCGTGGACAGGAGCAACCCTGGG No data
1177320520_1177320525 -6 Left 1177320520 21:19513915-19513937 CCTGCTTCCACCTGAATTCCGTG No data
Right 1177320525 21:19513932-19513954 TCCGTGGACAGGAGCAACCCTGG No data
1177320520_1177320528 6 Left 1177320520 21:19513915-19513937 CCTGCTTCCACCTGAATTCCGTG No data
Right 1177320528 21:19513944-19513966 AGCAACCCTGGGTTTCCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177320520 Original CRISPR CACGGAATTCAGGTGGAAGC AGG (reversed) Intergenic
No off target data available for this crispr