ID: 1177326858

View in Genome Browser
Species Human (GRCh38)
Location 21:19601857-19601879
Sequence ATGCCCTTCTAGAATAGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177326850_1177326858 22 Left 1177326850 21:19601812-19601834 CCTAATTTACTCCAAACCATGGG No data
Right 1177326858 21:19601857-19601879 ATGCCCTTCTAGAATAGTGAAGG No data
1177326855_1177326858 11 Left 1177326855 21:19601823-19601845 CCAAACCATGGGGGGAAAACAGA No data
Right 1177326858 21:19601857-19601879 ATGCCCTTCTAGAATAGTGAAGG No data
1177326856_1177326858 6 Left 1177326856 21:19601828-19601850 CCATGGGGGGAAAACAGACCTAA No data
Right 1177326858 21:19601857-19601879 ATGCCCTTCTAGAATAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177326858 Original CRISPR ATGCCCTTCTAGAATAGTGA AGG Intergenic
No off target data available for this crispr