ID: 1177329918

View in Genome Browser
Species Human (GRCh38)
Location 21:19645403-19645425
Sequence GCTAAATTGTCAGCCCAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177329918_1177329920 -5 Left 1177329918 21:19645403-19645425 CCTCACTGGGCTGACAATTTAGC No data
Right 1177329920 21:19645421-19645443 TTAGCAGAGAGGATACAAACAGG No data
1177329918_1177329922 19 Left 1177329918 21:19645403-19645425 CCTCACTGGGCTGACAATTTAGC No data
Right 1177329922 21:19645445-19645467 AATAGCCATCTAATAAAGTTGGG No data
1177329918_1177329921 18 Left 1177329918 21:19645403-19645425 CCTCACTGGGCTGACAATTTAGC No data
Right 1177329921 21:19645444-19645466 AAATAGCCATCTAATAAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177329918 Original CRISPR GCTAAATTGTCAGCCCAGTG AGG (reversed) Intergenic
No off target data available for this crispr