ID: 1177332142

View in Genome Browser
Species Human (GRCh38)
Location 21:19678689-19678711
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177332138_1177332142 19 Left 1177332138 21:19678647-19678669 CCTGAATTTAAATGTTGGTCTAT No data
Right 1177332142 21:19678689-19678711 TCTCCTGGATGATATCCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177332142 Original CRISPR TCTCCTGGATGATATCCTGA AGG Intergenic