ID: 1177336901

View in Genome Browser
Species Human (GRCh38)
Location 21:19740531-19740553
Sequence CACCTTGAAGTGATGAAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177336897_1177336901 12 Left 1177336897 21:19740496-19740518 CCTAGTAGTTAATGAGTATTGCT No data
Right 1177336901 21:19740531-19740553 CACCTTGAAGTGATGAAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177336901 Original CRISPR CACCTTGAAGTGATGAAGCT AGG Intergenic
No off target data available for this crispr