ID: 1177337431

View in Genome Browser
Species Human (GRCh38)
Location 21:19749446-19749468
Sequence TTGTCCCACTAGAAGTCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177337431_1177337434 -6 Left 1177337431 21:19749446-19749468 CCTGCAGACTTCTAGTGGGACAA No data
Right 1177337434 21:19749463-19749485 GGACAAGATTTGGAGATGGAAGG No data
1177337431_1177337433 -10 Left 1177337431 21:19749446-19749468 CCTGCAGACTTCTAGTGGGACAA No data
Right 1177337433 21:19749459-19749481 AGTGGGACAAGATTTGGAGATGG No data
1177337431_1177337437 26 Left 1177337431 21:19749446-19749468 CCTGCAGACTTCTAGTGGGACAA No data
Right 1177337437 21:19749495-19749517 TGATGAGCCTTACCTTGGGTAGG No data
1177337431_1177337436 22 Left 1177337431 21:19749446-19749468 CCTGCAGACTTCTAGTGGGACAA No data
Right 1177337436 21:19749491-19749513 ATATTGATGAGCCTTACCTTGGG No data
1177337431_1177337435 21 Left 1177337431 21:19749446-19749468 CCTGCAGACTTCTAGTGGGACAA No data
Right 1177337435 21:19749490-19749512 GATATTGATGAGCCTTACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177337431 Original CRISPR TTGTCCCACTAGAAGTCTGC AGG (reversed) Intergenic
No off target data available for this crispr