ID: 1177344475

View in Genome Browser
Species Human (GRCh38)
Location 21:19852433-19852455
Sequence CTTACACAGAATTAGATCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177344473_1177344475 19 Left 1177344473 21:19852391-19852413 CCTCTCTGAACTCTTACACTTTC No data
Right 1177344475 21:19852433-19852455 CTTACACAGAATTAGATCCAAGG No data
1177344474_1177344475 -10 Left 1177344474 21:19852420-19852442 CCAGAAGTTCAAACTTACACAGA No data
Right 1177344475 21:19852433-19852455 CTTACACAGAATTAGATCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177344475 Original CRISPR CTTACACAGAATTAGATCCA AGG Intergenic
No off target data available for this crispr