ID: 1177350749

View in Genome Browser
Species Human (GRCh38)
Location 21:19938271-19938293
Sequence TTGGACCCCCAAAATTATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177350749_1177350755 30 Left 1177350749 21:19938271-19938293 CCAGTATAATTTTGGGGGTCCAA No data
Right 1177350755 21:19938324-19938346 CCTTTTCAGTCCCAAACGGAAGG No data
1177350749_1177350753 26 Left 1177350749 21:19938271-19938293 CCAGTATAATTTTGGGGGTCCAA No data
Right 1177350753 21:19938320-19938342 CTGTCCTTTTCAGTCCCAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177350749 Original CRISPR TTGGACCCCCAAAATTATAC TGG (reversed) Intergenic
No off target data available for this crispr