ID: 1177351669

View in Genome Browser
Species Human (GRCh38)
Location 21:19951256-19951278
Sequence TTTCATCCTATGCCAATTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177351669_1177351674 19 Left 1177351669 21:19951256-19951278 CCACTAATTGGCATAGGATGAAA No data
Right 1177351674 21:19951298-19951320 AGGTGACAGATTAAGTCGTTTGG No data
1177351669_1177351673 -1 Left 1177351669 21:19951256-19951278 CCACTAATTGGCATAGGATGAAA No data
Right 1177351673 21:19951278-19951300 ATGTGGGTGTAGAGGCAAGCAGG No data
1177351669_1177351672 -9 Left 1177351669 21:19951256-19951278 CCACTAATTGGCATAGGATGAAA No data
Right 1177351672 21:19951270-19951292 AGGATGAAATGTGGGTGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177351669 Original CRISPR TTTCATCCTATGCCAATTAG TGG (reversed) Intergenic
No off target data available for this crispr