ID: 1177351673

View in Genome Browser
Species Human (GRCh38)
Location 21:19951278-19951300
Sequence ATGTGGGTGTAGAGGCAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177351669_1177351673 -1 Left 1177351669 21:19951256-19951278 CCACTAATTGGCATAGGATGAAA No data
Right 1177351673 21:19951278-19951300 ATGTGGGTGTAGAGGCAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177351673 Original CRISPR ATGTGGGTGTAGAGGCAAGC AGG Intergenic
No off target data available for this crispr