ID: 1177355761

View in Genome Browser
Species Human (GRCh38)
Location 21:20004702-20004724
Sequence GGATGAGTCAATGCAAATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177355761_1177355764 3 Left 1177355761 21:20004702-20004724 CCTCAATTTGCATTGACTCATCC No data
Right 1177355764 21:20004728-20004750 AATTTGCATGTAATTGAAGTGGG No data
1177355761_1177355763 2 Left 1177355761 21:20004702-20004724 CCTCAATTTGCATTGACTCATCC No data
Right 1177355763 21:20004727-20004749 TAATTTGCATGTAATTGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177355761 Original CRISPR GGATGAGTCAATGCAAATTG AGG (reversed) Intergenic
No off target data available for this crispr