ID: 1177355763

View in Genome Browser
Species Human (GRCh38)
Location 21:20004727-20004749
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177355760_1177355763 3 Left 1177355760 21:20004701-20004723 CCCTCAATTTGCATTGACTCATC No data
Right 1177355763 21:20004727-20004749 TAATTTGCATGTAATTGAAGTGG No data
1177355758_1177355763 27 Left 1177355758 21:20004677-20004699 CCTAGACAGTTTTAAGTAACATG No data
Right 1177355763 21:20004727-20004749 TAATTTGCATGTAATTGAAGTGG No data
1177355761_1177355763 2 Left 1177355761 21:20004702-20004724 CCTCAATTTGCATTGACTCATCC No data
Right 1177355763 21:20004727-20004749 TAATTTGCATGTAATTGAAGTGG No data
1177355759_1177355763 4 Left 1177355759 21:20004700-20004722 CCCCTCAATTTGCATTGACTCAT No data
Right 1177355763 21:20004727-20004749 TAATTTGCATGTAATTGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177355763 Original CRISPR TAATTTGCATGTAATTGAAG TGG Intergenic
No off target data available for this crispr