ID: 1177356646

View in Genome Browser
Species Human (GRCh38)
Location 21:20017395-20017417
Sequence TTCACAGTTCAGAGAGAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177356646_1177356649 27 Left 1177356646 21:20017395-20017417 CCTTACTCTCTCTGAACTGTGAA No data
Right 1177356649 21:20017445-20017467 AAGACCTTGATATCTTTGAAAGG No data
1177356646_1177356647 -1 Left 1177356646 21:20017395-20017417 CCTTACTCTCTCTGAACTGTGAA No data
Right 1177356647 21:20017417-20017439 AAGTATGTGAAATAGTTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177356646 Original CRISPR TTCACAGTTCAGAGAGAGTA AGG (reversed) Intergenic
No off target data available for this crispr