ID: 1177357090

View in Genome Browser
Species Human (GRCh38)
Location 21:20022287-20022309
Sequence TGAGTTACAATGTAACTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177357090_1177357095 8 Left 1177357090 21:20022287-20022309 CCAGGCAGTTACATTGTAACTCA No data
Right 1177357095 21:20022318-20022340 AAGGAAGTGTGTGCCCTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177357090 Original CRISPR TGAGTTACAATGTAACTGCC TGG (reversed) Intergenic
No off target data available for this crispr