ID: 1177367165

View in Genome Browser
Species Human (GRCh38)
Location 21:20153345-20153367
Sequence CAGGCTATGAAAGCAGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177367165_1177367168 4 Left 1177367165 21:20153345-20153367 CCTGCAGCTGCTTTCATAGCCTG No data
Right 1177367168 21:20153372-20153394 TAAGTGTTTGCTGCTTTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177367165 Original CRISPR CAGGCTATGAAAGCAGCTGC AGG (reversed) Intergenic
No off target data available for this crispr