ID: 1177367168

View in Genome Browser
Species Human (GRCh38)
Location 21:20153372-20153394
Sequence TAAGTGTTTGCTGCTTTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177367162_1177367168 29 Left 1177367162 21:20153320-20153342 CCTTGTGGCTCTGTAGTGTACAG No data
Right 1177367168 21:20153372-20153394 TAAGTGTTTGCTGCTTTTCCAGG No data
1177367163_1177367168 6 Left 1177367163 21:20153343-20153365 CCCCTGCAGCTGCTTTCATAGCC No data
Right 1177367168 21:20153372-20153394 TAAGTGTTTGCTGCTTTTCCAGG No data
1177367165_1177367168 4 Left 1177367165 21:20153345-20153367 CCTGCAGCTGCTTTCATAGCCTG No data
Right 1177367168 21:20153372-20153394 TAAGTGTTTGCTGCTTTTCCAGG No data
1177367164_1177367168 5 Left 1177367164 21:20153344-20153366 CCCTGCAGCTGCTTTCATAGCCT No data
Right 1177367168 21:20153372-20153394 TAAGTGTTTGCTGCTTTTCCAGG No data
1177367161_1177367168 30 Left 1177367161 21:20153319-20153341 CCCTTGTGGCTCTGTAGTGTACA No data
Right 1177367168 21:20153372-20153394 TAAGTGTTTGCTGCTTTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177367168 Original CRISPR TAAGTGTTTGCTGCTTTTCC AGG Intergenic
No off target data available for this crispr