ID: 1177369815

View in Genome Browser
Species Human (GRCh38)
Location 21:20187714-20187736
Sequence ATGAAAACCTAGAATTATTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177369815_1177369817 28 Left 1177369815 21:20187714-20187736 CCATAATAATTCTAGGTTTTCAT No data
Right 1177369817 21:20187765-20187787 CACATAATGAGTACTTATGAGGG No data
1177369815_1177369818 29 Left 1177369815 21:20187714-20187736 CCATAATAATTCTAGGTTTTCAT No data
Right 1177369818 21:20187766-20187788 ACATAATGAGTACTTATGAGGGG No data
1177369815_1177369816 27 Left 1177369815 21:20187714-20187736 CCATAATAATTCTAGGTTTTCAT No data
Right 1177369816 21:20187764-20187786 TCACATAATGAGTACTTATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177369815 Original CRISPR ATGAAAACCTAGAATTATTA TGG (reversed) Intergenic
No off target data available for this crispr