ID: 1177371629

View in Genome Browser
Species Human (GRCh38)
Location 21:20211422-20211444
Sequence CTTTATAAGCAGATATTGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177371629_1177371630 9 Left 1177371629 21:20211422-20211444 CCTTACAATATCTGCTTATAAAG No data
Right 1177371630 21:20211454-20211476 TTTATTACCAATGTGAATCTTGG No data
1177371629_1177371631 14 Left 1177371629 21:20211422-20211444 CCTTACAATATCTGCTTATAAAG No data
Right 1177371631 21:20211459-20211481 TACCAATGTGAATCTTGGACTGG No data
1177371629_1177371632 15 Left 1177371629 21:20211422-20211444 CCTTACAATATCTGCTTATAAAG No data
Right 1177371632 21:20211460-20211482 ACCAATGTGAATCTTGGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177371629 Original CRISPR CTTTATAAGCAGATATTGTA AGG (reversed) Intergenic
No off target data available for this crispr