ID: 1177373724

View in Genome Browser
Species Human (GRCh38)
Location 21:20240759-20240781
Sequence GTACGCCCCATGGCAAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177373719_1177373724 21 Left 1177373719 21:20240715-20240737 CCTCAAGAAGCTTCTAATAATGA No data
Right 1177373724 21:20240759-20240781 GTACGCCCCATGGCAAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177373724 Original CRISPR GTACGCCCCATGGCAAAAGC AGG Intergenic
No off target data available for this crispr