ID: 1177374202

View in Genome Browser
Species Human (GRCh38)
Location 21:20248013-20248035
Sequence GGCTGGCCACAACTTTAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177374202_1177374208 25 Left 1177374202 21:20248013-20248035 CCAAGCTAAAGTTGTGGCCAGCC No data
Right 1177374208 21:20248061-20248083 AATTTAGCTTGACATCTAAGGGG No data
1177374202_1177374207 24 Left 1177374202 21:20248013-20248035 CCAAGCTAAAGTTGTGGCCAGCC No data
Right 1177374207 21:20248060-20248082 CAATTTAGCTTGACATCTAAGGG No data
1177374202_1177374206 23 Left 1177374202 21:20248013-20248035 CCAAGCTAAAGTTGTGGCCAGCC No data
Right 1177374206 21:20248059-20248081 ACAATTTAGCTTGACATCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177374202 Original CRISPR GGCTGGCCACAACTTTAGCT TGG (reversed) Intergenic
No off target data available for this crispr