ID: 1177378471

View in Genome Browser
Species Human (GRCh38)
Location 21:20305363-20305385
Sequence CTAGATAAACAAATGGACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177378471_1177378473 -7 Left 1177378471 21:20305363-20305385 CCATTGTCCATTTGTTTATCTAG No data
Right 1177378473 21:20305379-20305401 TATCTAGTCTCAGTTTTCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177378471 Original CRISPR CTAGATAAACAAATGGACAA TGG (reversed) Intergenic
No off target data available for this crispr