ID: 1177380181

View in Genome Browser
Species Human (GRCh38)
Location 21:20330772-20330794
Sequence ACTGAGAAGCCCAAGGCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177380177_1177380181 30 Left 1177380177 21:20330719-20330741 CCTGAAACTGGATCATTCATAAT No data
Right 1177380181 21:20330772-20330794 ACTGAGAAGCCCAAGGCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177380181 Original CRISPR ACTGAGAAGCCCAAGGCTGA GGG Intergenic
No off target data available for this crispr