ID: 1177381167

View in Genome Browser
Species Human (GRCh38)
Location 21:20346357-20346379
Sequence AATGAAAAGCAGAATGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177381167_1177381169 0 Left 1177381167 21:20346357-20346379 CCATCCACATTCTGCTTTTCATT No data
Right 1177381169 21:20346380-20346402 TTCCCAGCTCTATTAGTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177381167 Original CRISPR AATGAAAAGCAGAATGTGGA TGG (reversed) Intergenic
No off target data available for this crispr