ID: 1177388209

View in Genome Browser
Species Human (GRCh38)
Location 21:20433834-20433856
Sequence AGGGCTGCTGCAGTTTGCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177388209_1177388216 20 Left 1177388209 21:20433834-20433856 CCCCGGCAAACTGCAGCAGCCCT No data
Right 1177388216 21:20433877-20433899 TTAAAAGAAAAACAGACAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177388209 Original CRISPR AGGGCTGCTGCAGTTTGCCG GGG (reversed) Intergenic
No off target data available for this crispr