ID: 1177394180

View in Genome Browser
Species Human (GRCh38)
Location 21:20511550-20511572
Sequence TAAAATGCTGATAGTGATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177394180_1177394182 1 Left 1177394180 21:20511550-20511572 CCCATATCACTATCAGCATTTTA No data
Right 1177394182 21:20511574-20511596 TCAAAACCTTTCAAGTCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177394180 Original CRISPR TAAAATGCTGATAGTGATAT GGG (reversed) Intergenic
No off target data available for this crispr