ID: 1177394425

View in Genome Browser
Species Human (GRCh38)
Location 21:20513846-20513868
Sequence AGCTCAGTTCCCTAATATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177394425_1177394429 13 Left 1177394425 21:20513846-20513868 CCCAAATATTAGGGAACTGAGCT No data
Right 1177394429 21:20513882-20513904 GAAGCTGCCCTAAGAACTGGAGG No data
1177394425_1177394430 17 Left 1177394425 21:20513846-20513868 CCCAAATATTAGGGAACTGAGCT No data
Right 1177394430 21:20513886-20513908 CTGCCCTAAGAACTGGAGGACGG No data
1177394425_1177394428 10 Left 1177394425 21:20513846-20513868 CCCAAATATTAGGGAACTGAGCT No data
Right 1177394428 21:20513879-20513901 CTAGAAGCTGCCCTAAGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177394425 Original CRISPR AGCTCAGTTCCCTAATATTT GGG (reversed) Intergenic
No off target data available for this crispr