ID: 1177394426

View in Genome Browser
Species Human (GRCh38)
Location 21:20513847-20513869
Sequence GAGCTCAGTTCCCTAATATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177394426_1177394429 12 Left 1177394426 21:20513847-20513869 CCAAATATTAGGGAACTGAGCTC No data
Right 1177394429 21:20513882-20513904 GAAGCTGCCCTAAGAACTGGAGG No data
1177394426_1177394428 9 Left 1177394426 21:20513847-20513869 CCAAATATTAGGGAACTGAGCTC No data
Right 1177394428 21:20513879-20513901 CTAGAAGCTGCCCTAAGAACTGG No data
1177394426_1177394433 30 Left 1177394426 21:20513847-20513869 CCAAATATTAGGGAACTGAGCTC No data
Right 1177394433 21:20513900-20513922 GGAGGACGGTATAGCATCCCAGG No data
1177394426_1177394430 16 Left 1177394426 21:20513847-20513869 CCAAATATTAGGGAACTGAGCTC No data
Right 1177394430 21:20513886-20513908 CTGCCCTAAGAACTGGAGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177394426 Original CRISPR GAGCTCAGTTCCCTAATATT TGG (reversed) Intergenic
No off target data available for this crispr