ID: 1177394430

View in Genome Browser
Species Human (GRCh38)
Location 21:20513886-20513908
Sequence CTGCCCTAAGAACTGGAGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177394425_1177394430 17 Left 1177394425 21:20513846-20513868 CCCAAATATTAGGGAACTGAGCT No data
Right 1177394430 21:20513886-20513908 CTGCCCTAAGAACTGGAGGACGG No data
1177394426_1177394430 16 Left 1177394426 21:20513847-20513869 CCAAATATTAGGGAACTGAGCTC No data
Right 1177394430 21:20513886-20513908 CTGCCCTAAGAACTGGAGGACGG No data
1177394422_1177394430 27 Left 1177394422 21:20513836-20513858 CCAGATTTTTCCCAAATATTAGG No data
Right 1177394430 21:20513886-20513908 CTGCCCTAAGAACTGGAGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177394430 Original CRISPR CTGCCCTAAGAACTGGAGGA CGG Intergenic
No off target data available for this crispr