ID: 1177396983

View in Genome Browser
Species Human (GRCh38)
Location 21:20549216-20549238
Sequence GTGTTGGAGGAGAAGCCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177396973_1177396983 9 Left 1177396973 21:20549184-20549206 CCCCCAAATCTCATGTCAGATTG No data
Right 1177396983 21:20549216-20549238 GTGTTGGAGGAGAAGCCTGGTGG No data
1177396975_1177396983 7 Left 1177396975 21:20549186-20549208 CCCAAATCTCATGTCAGATTGTA No data
Right 1177396983 21:20549216-20549238 GTGTTGGAGGAGAAGCCTGGTGG No data
1177396976_1177396983 6 Left 1177396976 21:20549187-20549209 CCAAATCTCATGTCAGATTGTAA No data
Right 1177396983 21:20549216-20549238 GTGTTGGAGGAGAAGCCTGGTGG No data
1177396974_1177396983 8 Left 1177396974 21:20549185-20549207 CCCCAAATCTCATGTCAGATTGT No data
Right 1177396983 21:20549216-20549238 GTGTTGGAGGAGAAGCCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177396983 Original CRISPR GTGTTGGAGGAGAAGCCTGG TGG Intergenic
No off target data available for this crispr