ID: 1177401916

View in Genome Browser
Species Human (GRCh38)
Location 21:20615506-20615528
Sequence TGGACAATACAGATAGTACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177401916_1177401920 14 Left 1177401916 21:20615506-20615528 CCATGTACTATCTGTATTGTCCA No data
Right 1177401920 21:20615543-20615565 ATAATAACCAGGGAATAACATGG No data
1177401916_1177401918 3 Left 1177401916 21:20615506-20615528 CCATGTACTATCTGTATTGTCCA No data
Right 1177401918 21:20615532-20615554 TAAAAAAAGAAATAATAACCAGG No data
1177401916_1177401919 4 Left 1177401916 21:20615506-20615528 CCATGTACTATCTGTATTGTCCA No data
Right 1177401919 21:20615533-20615555 AAAAAAAGAAATAATAACCAGGG No data
1177401916_1177401921 15 Left 1177401916 21:20615506-20615528 CCATGTACTATCTGTATTGTCCA No data
Right 1177401921 21:20615544-20615566 TAATAACCAGGGAATAACATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177401916 Original CRISPR TGGACAATACAGATAGTACA TGG (reversed) Intergenic
No off target data available for this crispr