ID: 1177402377

View in Genome Browser
Species Human (GRCh38)
Location 21:20623000-20623022
Sequence ATGCAAGTCCAAAACTCAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177402373_1177402377 2 Left 1177402373 21:20622975-20622997 CCAAAAGAAAGGGGCTACAAGCC 0: 4
1: 144
2: 1054
3: 1778
4: 1877
Right 1177402377 21:20623000-20623022 ATGCAAGTCCAAAACTCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177402377 Original CRISPR ATGCAAGTCCAAAACTCAAA AGG Intergenic
No off target data available for this crispr