ID: 1177404935

View in Genome Browser
Species Human (GRCh38)
Location 21:20654343-20654365
Sequence AAGGATGCTGAACATTGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177404935_1177404937 -9 Left 1177404935 21:20654343-20654365 CCTTGCCAATGTTCAGCATCCTT No data
Right 1177404937 21:20654357-20654379 AGCATCCTTACATCAAATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177404935 Original CRISPR AAGGATGCTGAACATTGGCA AGG (reversed) Intergenic
No off target data available for this crispr