ID: 1177405557

View in Genome Browser
Species Human (GRCh38)
Location 21:20663138-20663160
Sequence CTCTCAAAGGGAAAGGGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177405557_1177405566 14 Left 1177405557 21:20663138-20663160 CCAGTCCCCTTTCCCTTTGAGAG No data
Right 1177405566 21:20663175-20663197 ACCCCATTTAAGCTGAACTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177405557 Original CRISPR CTCTCAAAGGGAAAGGGGAC TGG (reversed) Intergenic
No off target data available for this crispr