ID: 1177406525

View in Genome Browser
Species Human (GRCh38)
Location 21:20674685-20674707
Sequence AACAGACAGCAGGCCAGATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177406521_1177406525 17 Left 1177406521 21:20674645-20674667 CCCTAGTCTACTGTTGCTGGAGA No data
Right 1177406525 21:20674685-20674707 AACAGACAGCAGGCCAGATTTGG No data
1177406522_1177406525 16 Left 1177406522 21:20674646-20674668 CCTAGTCTACTGTTGCTGGAGAA No data
Right 1177406525 21:20674685-20674707 AACAGACAGCAGGCCAGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177406525 Original CRISPR AACAGACAGCAGGCCAGATT TGG Intergenic
No off target data available for this crispr