ID: 1177407364

View in Genome Browser
Species Human (GRCh38)
Location 21:20687220-20687242
Sequence TAGCTCAGACTGCCATAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177407364_1177407366 -4 Left 1177407364 21:20687220-20687242 CCAGTTTATGGCAGTCTGAGCTA No data
Right 1177407366 21:20687239-20687261 GCTAAGACAGGCATCCATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177407364 Original CRISPR TAGCTCAGACTGCCATAAAC TGG (reversed) Intergenic
No off target data available for this crispr