ID: 1177408599

View in Genome Browser
Species Human (GRCh38)
Location 21:20701612-20701634
Sequence GTGTGTTCGGGGGGGGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177408599_1177408614 16 Left 1177408599 21:20701612-20701634 CCCCCCACCCCCCCCGAACACAC No data
Right 1177408614 21:20701651-20701673 CCCTGGAGTACCAACTTCCCTGG No data
1177408599_1177408611 -1 Left 1177408599 21:20701612-20701634 CCCCCCACCCCCCCCGAACACAC No data
Right 1177408611 21:20701634-20701656 CACACACACACACGCCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177408599 Original CRISPR GTGTGTTCGGGGGGGGTGGG GGG (reversed) Intergenic
No off target data available for this crispr