ID: 1177410663

View in Genome Browser
Species Human (GRCh38)
Location 21:20726434-20726456
Sequence AAATACATCTTCAGGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177410659_1177410663 -7 Left 1177410659 21:20726418-20726440 CCAATATCTAAGATAGAAATACA No data
Right 1177410663 21:20726434-20726456 AAATACATCTTCAGGGAGGAAGG No data
1177410658_1177410663 -6 Left 1177410658 21:20726417-20726439 CCCAATATCTAAGATAGAAATAC No data
Right 1177410663 21:20726434-20726456 AAATACATCTTCAGGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177410663 Original CRISPR AAATACATCTTCAGGGAGGA AGG Intergenic
No off target data available for this crispr