ID: 1177411374 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 21:20734352-20734374 |
Sequence | ATGGCTTTCTAGTCGAGTGA AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1177411367_1177411374 | 27 | Left | 1177411367 | 21:20734302-20734324 | CCTCAGAGAGACATGGGGAGTGG | No data | ||
Right | 1177411374 | 21:20734352-20734374 | ATGGCTTTCTAGTCGAGTGAAGG | No data | ||||
1177411373_1177411374 | -10 | Left | 1177411373 | 21:20734339-20734361 | CCTGATCACACACATGGCTTTCT | No data | ||
Right | 1177411374 | 21:20734352-20734374 | ATGGCTTTCTAGTCGAGTGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1177411374 | Original CRISPR | ATGGCTTTCTAGTCGAGTGA AGG | Intergenic | ||
No off target data available for this crispr |