ID: 1177411374

View in Genome Browser
Species Human (GRCh38)
Location 21:20734352-20734374
Sequence ATGGCTTTCTAGTCGAGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177411367_1177411374 27 Left 1177411367 21:20734302-20734324 CCTCAGAGAGACATGGGGAGTGG No data
Right 1177411374 21:20734352-20734374 ATGGCTTTCTAGTCGAGTGAAGG No data
1177411373_1177411374 -10 Left 1177411373 21:20734339-20734361 CCTGATCACACACATGGCTTTCT No data
Right 1177411374 21:20734352-20734374 ATGGCTTTCTAGTCGAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177411374 Original CRISPR ATGGCTTTCTAGTCGAGTGA AGG Intergenic
No off target data available for this crispr